Query (optional)   in Class  

GrainGenes Sequence Report: D00206

[ Printable Version ]  [ Submit comment/correction ]

Sequence
D00206
Subsequence
D00206_1.cds961529
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC356437
Data at Gramene
Gramene-Protein P11383
DB Remark
Locus Source: chloroplast Triticum aestivum (bread wheat)
Keyword
ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (H-type)
Rubisco
rbcL
chloroplast
Species
Triticum aestivum
Developmental Stage
young seedling
Data Source
genbankRelease 135, Apr 15 2003
Title
Triticum aestivum chloroplast gene for ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (H-type), complete cds.
Remark
DB_xref: taxon:4565
[ Show all 10 ]
EMBL Feature
variation101010Location: 10
[ Show all 7 ]
DNA
gagatttttgctaaagtttcatttacgcctaattaacatcgagtagaccc
tgttattgtgagaattcttaattcaagagttatagggagggacttatgtc
accacaaacagaaactaaagcaggtgttggatttaaagctggtgttaaag
attataaattgacttactacaccccagagtatgaaactaaggatactgat
atcttggcagcattccgagtaagtcctcagcctggggttccgcccgaaga
agcaggggctgcagtagctgccgaatcttctactggtacatggacaactg
tttggactgatggacttaccagtcttgatcgttacaaaggacgatgctat
cacatcgagcctgttgctggggaagacagccaatggatctgttatgtagc
ttatccattagacctatttgaagagggttccgttactaacatgtttactt
ccattgtaggtaacgtatttggtttcaaagccctacgtgctctacgtttg
gaggatctacgaattccccctacttattcaaaaactttccaaggcccgcc
tcatggtatccaagttgaaagagataagttgaacaagtatggtcgtcctt
tattgggatgtactattaaaccaaaattgggattatccgcaaaaaattat
ggtagagcgtgttatgagtgtctacgtggtggacttgattttaccaaaga
tgatgaaaacgtaaactcacaaccatttatgcgctggagagaccgttttg
tcttttgtgccgaagctatttataaatcacaggccgaaaccggtgaaatc
aaggggcattacttgaatgcgactgcgggtacatgtgaagaaatgattaa
gagagctgtatttgcaagagaattaggggttcctattgtaatgcatgact
acttaactgggggattcaccgcaaatactactttggctcattattgccgc
gacaatggcctacttcttcacattcaccgtgcaatgcatgcagttattga
tagacagaaaaatcatggtatgcatttccgtgtattagctaaagcattgc
gtatgtctgggggagatcatatccactccggtacagtagtaggtaagtta
gaaggggaacgcgaaatgactttaggttttgttgatttattgcgcgatga
ttttattgaaaaagatcgtgctcgcggtatctttttcactcaggactggg
tatccatgccaggtgttataccggtagcttcaggtggtattcatgtttgg
catatgccagctctgaccgaaatctttggggacgattctgtattacaatt
tggtggaggaactttaggacatccttggggaaatgcacctggtgcagcag
ctaatcgagtggctttagaagcctgtgtacaagctcgtaacgaagggcgc
gatcttgctcgcgaaggtaatgaaattatccgagcagcttgcaaatggag
tcctgaactagccgcagcttgtgaagtatggaaggcgatcaaattcgagt
tcgagccggtagatactattgataagtagataaaactaaagataaagaag
agaaggtataaataaaaaagaaacgaaataaaaagagaaaaaaataagtt
atgaaatgcagtaattcttctttattcttctaattgattgcaattaaact
cggctcaatcttttttttctaaaaaagattgagccgaataaaaatagatc
atgatatgatcatgagacttgacaaatcgagattcgtctattctatatat
ctaga
BLAST
BLAST Search