Query (optional)   in Class  

GrainGenes Sequence Report: J05486

[ Printable Version ]  [ Submit comment/correction ]

Sequence
J05486
Subsequence
J05486_1.cds4841113
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
Data at Gramene
Gramene-Protein Q38794
DB Remark
Locus Source: Avena sativa (oat)
Keyword
avenin
prolamine
storage protein
Species
Avena sativa
Data Source
genbankRelease 141, Apr 15 2004
Title
A.sativa seed storage protein gene, complete cds.
Gene Product
seed storage protein mRNA
Remark
DB_xref: taxon:4498
Feature: source: mol_type = 'genomic DNA'
Locus Comment: Original source text: A.sativa (genomic library lambda-Charon-34),; clone lambda-AV45-X1.; Draft entry and computer-readable sequence for [1] kindly submitted; by M.A.Shotwell, 17-APR-1990.
EMBL Feature
TATA_signal380384Location: 380..384
misc_signal343347CAT boxLocation: 343..347
polyA_signal11891194Location: 1189..1194
polyA_signal12521258Location: 1252..1258
DNA
tctagaacaatccttcctgttactagtttaatctaccttatacacagaca
agtttacaaactttgcaagccatgacaatatggtttatgcctaacagcct
gtagaaaaacacaaacttagtttcagaaaatgatgcaatatagatcagtg
attgacatgtaaagcgaaaaagatgagacatattgccaactatcaagctt
tcttgatagtcgaaaggtgatacatgtaatggcaaagcaacttttatgat
cgatccaaaaataacatttgtaggtagtgccaccaaacacaacataccaa
ataatcagttcgagaagcatacaagcattttttaaggaaaagcaaatgca
aagatgaaaagaaactatgccatggcagatataaatagacctgcaccatg
gagatcctcctccatcattcatccttcacacaccgagagcacaaacatta
aaacctagcaagcagtatcaacacaaatctaccatgaagaacttcctcat
ccttgccctcctttccatggcggcgaccatggccactgcgcagtttgacc
ctagcgaacaataccagccatatcctgagcaacaacagccaattctacaa
caacagttgctgttgcagcaacaacaacagatgttgttgcagcaacaacc
attgttgcaggttttgcagcaacagttgaacccatgcaggcagttcctcg
tgcaacagtgcagcccggtggcagcggtgtcattcctccggtcgcaaatc
ctgcaacagagcagctgccaggtgatgaggcaacaatgctgccgacggct
ggagcagatccccgagcagctccggtgcccagccatccatagcgtcgtcc
aggccatcattatgcagcaacaacaacaacagttcttccagcctcagatg
caacaacagttcttccagcctcagatgcaacaggtgacacagggcatctt
ccagcctcagatgcaacaggtgacacagggcatcttccagactcagatgc
aaggtcagatcgaggggatgagggcgtttgcgctgcaggccctgccggcg
atgtgcgatgtatacgtcccgccgcactgccccgtcgccaccaccccgct
cagtggcttctaagaacactacaagagctatagtactacataaataccat
cagcgtttagccgatggaccgatcttgtagcggtgacaaataaaataaaa
gggtcatgcactaacatgtgtgacagccgacccgtactagtccaaacttg
gaaataaaagaatgcaaagttcttgtctgcataacattgattgtcgtttt
tccattcatgtttatacctaaccataagctcatgcattaactagctgctt
atgtagccttcattgatgtgaacataataacagagtgggtgtaaaagatg
gatttgaattgaggcactattaaagtgaggagtaagaaccaggtgcagat
gatagctctttaatggtgaggcttgtgagttgtgaccttattggctgaca
tgcattggattctaaagagtacatgttgatgctttcaacaatgtcgac
BLAST
BLAST Search