Query (optional)   in Class  

GrainGenes Marker Report: Xgwm408-5B.1

[Submit comment/correction]

Locus
Xgwm408-5B.1
Type
Microsatellite
Chromosome
5B
Chromosome Arm
5BL
Map
Tt-Oxd-QTL-5B162.9
[ Show Nearby Loci ]
Map Data
T. turgidum, Omrabi5 x dicoccoides, QTL
Probe
WMS408
Possible Orthologs
Xgwm408
[ Show all 12 ]



Probe for Locus
WMS408
Locus
Xgwm408-5B
[ Show all 13 ]
Reference
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
General Remarks
Insert contains repeat (CA)>22(TA)(CA)7(TA)9
PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER.
Type
PCR
SSR
PCR primers
5' TCGATTTATTTGGGCCACTG 3'
5' GTATAATTCGTTCACAGCACGC 3'
Amplification Conditions
3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 55 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism
WMS408
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
Data Source
Roeder, Marion S.98.09.15

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.