Query (optional)   in Class  

GrainGenes Marker Report: XksuA1

[ Printable Version ]  [ Submit comment/correction ]

Locus
XksuA1
Type
RFLP
Chromosome
5B
7D
Chromosome Arm
7DS
Map
Ta-Physical-Gill-5D0.9
Ta-Physical-Gill-7ABD-81
Wheat-Composite2004-5B55
[ Show Nearby Loci ]
Breakpoint Interval
Cent/5DL-7
7S-0.61-1.00
Map Data
Wheat, Composite, 2004
Wheat, Physical
Species
Triticum aestivum
Probe
pTtksuA1
Reference
ReferenceBoyko EV et al. (1999) A high-density genetic linkage map of Aegilops tauschii, the D-genome progenitor of bread wheat. Theoretical and Applied Genetics 99:16-26.
Possible Orthologs
A001
[ Show all 24 ]



Probe for Locus
pTtksuA1
Locus
Xksu-A1
[ Show all 26 ]
Reference
ReferenceGill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type
Genomic
STS
PCR primers
R:AAGATTGTCAACAAGTGCC
L:CAACAGAGATATTGCCGTAG
Polymorphism
KSUA1 DraI
KSUA1 XbaI
KSUA1 EcoRI
KSUA1 EcoRV
KSUA1 HindIII
Linkage Group
7D / 7DS
Barley 1 (7H)
Insert Enzyme
PstI
Source Species
Triticum tauschii
Insert Size
1.2
Clone Vector
pUC18
pUC
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Gill, Bikram S.
Clone Authority
Gill, Bikram S.
Image
KSUA1 KO autoradiogram
KSUA1 SO autoradiogram
Data Source
Talbert, Luther E.94.09.12
ATMI92.09
Kleinhofs, Andris96.05.08
Gill, Bikram S.92.09