Query (optional)   in Class  

GrainGenes Marker Report: Nax2

[ Printable Version ]  [ Submit comment/correction ]

Locus
Nax2
Type
Trait
Chromosome
5A
Chromosome Arm
5AL
Map
Wheat-Composite2004-5A105
[ Show Nearby Loci ]
Species
Triticum aestivum
Probe
WMS291
Associated Gene
Nax2 (Triticum)
Gene Class
Response to salinity
Reference
ReferenceByrt CS et al. (2007) HKT1;5-like cation transporters linked to Na+ exclusion loci in wheat, Nax2 and Kna1. Plant Physiology 143:1918-1928.
Data Source
Wheat Gene Catalogue
Remark
Trait marker Xgwm291-5A
Nearby marker on Composite map: Xgwm291
Position on Composite map estimated by GrainGenes.



Probe for Locus
WMS291
Locus
Xgwm291-5A
[ Show all 12 ]
Reference
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
General Remarks
Insert contains repeat (CA)35
PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER.
Type
PCR
SSR
PCR primers
5' CATCCCTACGCCACTCTGC 3'
5' AATGGTATCTATTCCGACCCG 3'
Amplification Conditions
3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 60 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism
WMS291
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
Data Source
Roeder, Marion S.98.09.15



Gene Associated with Locus
Nax2 (Triticum)
Gene Class
Response to salinity
Locus
Nax2
Reference
ReferenceByrt CS et al. (2007) HKT1;5-like cation transporters linked to Na+ exclusion loci in wheat, Nax2 and Kna1. Plant Physiology 143:1918-1928.
Chromosome
5A
Chromosome Arm
5AL