Query (optional)   in Class  

GrainGenes Probe Report: BF482960-4D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BF482960-4D
Data at Wheat_SNP
BF482960-4D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP T>C;T>C;C>T;T>C at 629;731;833;884
[ Show all 6 ]
Type
EST
SNP
PCR primers
BF482960_cpR1 CTATCTGCCCAAAACCTCCA
BF482960D_F1 GTGGTTTCTTTCGATTTTGCAT
Sequence
NSFT03P2_Contig2129
Linkage Group
4D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01