Query (optional)   in Class  

GrainGenes Sequence Report: 5AL_2701154

[Submit comment/correction]

Sequence
wsnp_Ex_c1481_2831499
Contig
5AL_2701154
Probe
wsnp_Ex_c1481_2831499
DNA Homology
5AL_2701154Best IWGSC match1716e-40URGI_BestIWGSC_N
BLAST, e-value
6e-405AL_2701154Best IWGSC match
DNA
aaagaattccattcaactctgcccagctgaaataactagtactgtagtta
tagaacaccttcacaccaaaatatagaaatgtatgcgtaaggcacctcct
Rcaagccatctctaagaaatcacatgaaactcatgtggcaaatgtccttt
ccgatccctcattttctggaattgtatcatgatttggtcatcaggaatgc
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.