Query (optional)   in Class  

GrainGenes Sequence Report: Ta.30803.1.S1_x_at

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Ta.30803.1.S1_x_at
Contigset
Affymetrix Wheat1 GeneChip
Contig Members
AL819229
[ Show all 186 ]
Data at PLEXdb
Probe annotation
Data Source
Affymetrix2006.02
DNA
nnncagctnntnnnnnnnntnnnncccnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnncgnnnncncnnncnnnnnccnnnn
nnncnccnncagccaatcctccccancccaagctcgcagccatgcctccc
aagctcgacccgtcccagatcgtggaggtgtatgtccgcgtcaccggcgg
ggaggtcggcgctgcgtcgtccctggcccccaagatcggnccgctcggtc
tctccccaaagaagatcggagaagacatcgccaaggagacggccaaggac
tggaagggcctccgcgtcaccgtcaagctcaccgtncagaatcgccaggc
caaggtgtccgtcgtcccctccgccgcagccctcgtcatcaaggcgctca
aggagcccgagagggaccgcaagaaggtcaagaacatcaagcacancggc
aacatcagcctcgacgacgtcatcgagatcgccaagatcatgaaggtccg
ctccatggccaaggagatggccggcaccgtcaaggagatcctnggcacct
gcgtcagcgtcggctgcaccgtngacggcaaggaccccaaggatctgcag
acggagatcgacgacggcgaggtggagatccccgcttaagaaggcttggc
tttgggnaggttgttatgtgaggctgctgaagtagtttctcctatctaga
tgcttcctgatgcanttgagagaatggatgtgatntcttcacttgttcta
ctcntgcngaagaagaaacttttgtcatgctttantggttccattgtgag
actatttttnnactgnnnntnanngagtaccttncggaatcaatcaatgt
tattatggcagctagaatatcanannnnnannnnnnncannnnnnnnnnn
ngnnnnnncnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntnnnnnnnnnnnnnnn
nncgcataggctggta
BLAST
BLAST Search